Hong Life CalculatorsUnderstanding the primer Tm and GC% calculator — concept and principle
The melting temperature (Tm) of a primer is the temperature at which half of the primer molecules are bound to their complementary strand. It guides the annealing temperature in PCR, the pairing of forward and reverse primers, and probe design. This calculator gives two quick Tm estimates, the GC content, the length and the molecular weight of a single-stranded DNA oligo.
How it is calculated
- Salt-adjusted Tm = 81.5 + 16.6 log₁₀[Na⁺] + 0.41 × (%GC) − 600 ÷ N, with [Na⁺] in mol/L (the mM input divided by 1000) and N the length in nucleotides.
- Wallace rule: Tm = 2(A + T) + 4(G + C), counting bases.
- GC content = (G + C) ÷ N × 100.
- MW = 313.21·A + 304.2·T + 329.21·G + 289.18·C − 61.96 g/mol, for an unmodified oligo without a 5′ phosphate.
Letters other than A, C, G and T are ignored.
The principle
G·C pairs form three hydrogen bonds and stack more strongly than A·T pairs with two, so GC-rich duplexes need more heat to separate. Longer duplexes have more contacts, but each extra base adds less, which the −600/N term captures. Cations shield the negatively charged phosphate backbones, so higher salt stabilises the duplex; the log term reflects this. The Wallace rule is a shortcut fitted to short oligos in high salt and overestimates Tm for longer primers. Nearest-neighbour models, which sum the stability of each adjacent base pair, are more accurate.
Worked example
- Sequence AGCGGATAACAATTTCACACAGGA: N = 24, A = 10, T = 4, G = 5, C = 5.
- GC = 10 ÷ 24 × 100 = 41.67%.
- Salt-adjusted: 81.5 + 16.6 × log₁₀(0.05) + 0.41 × 41.67 − 600 ÷ 24 = 81.5 − 21.60 + 17.08 − 25.00 = 51.99 °C.
- Wallace: 2 × 14 + 4 × 10 = 68 °C.
- MW = 10 × 313.21 + 4 × 304.2 + 5 × 329.21 + 5 × 289.18 − 61.96 = 7,378.89 g/mol.
| Na⁺ (mM) | Tm, salt-adjusted (°C) |
|---|---|
| 12.5 | 41.99203955 |
| 25 | 46.98913748 |
| 37.5 | 49.91225238 |
| 50 | 51.98623541 |
| 62.5 | 53.59494162 |
| 75 | 54.90935031 |
| 100 | 56.98333333 |
How to read the result
Common design rules of thumb are a length of about 18–25 nt, GC content of about 40–60%, and forward and reverse primers within about 5 °C of each other. A starting annealing temperature is often set a few degrees below the lower primer Tm and then optimised. The two estimates here differ by 16 °C, which shows why the Wallace rule should be reserved for short oligos. Real reactions also contain Mg²⁺, which raises Tm, so polymerase vendors' calculators may give higher values.
Common mistakes
- Comparing Tm values from different formulas or tools.
- Entering Na⁺ in mol/L instead of mM.
- Including the 5′ tail or restriction site when estimating initial annealing.
Frequently asked questions
Why does my polymerase supplier's Tm differ?
Supplier tools usually use nearest-neighbour thermodynamics with their own buffer conditions, so their numbers are not interchangeable with these.
How do I convert MW to concentration?
Divide the mass concentration by MW; for example 7.38 µg/mL of this oligo is about 1 µM.
Sources: Wallace, R. B. et al. (1979), Nucleic Acids Research 6, 3543–3557 · SantaLucia, J. (1998), Proceedings of the National Academy of Sciences 95, 1460–1465 · Sambrook, J. and Russell, D. W., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press)