Reverse Complement & Translation Tool

Understanding the reverse complement and translation tool — concept and principle

DNA is double-stranded, and the two strands run in opposite directions. Whenever you design a reverse primer, check a sequencing read from the other strand, or look for an open reading frame, you need the reverse complement of a sequence and often its protein translation. This tool returns both, together with the sequence length.

How it is calculated

• The input is cleaned: letters are made upper case and anything other than A, C, G, T or N is removed.
• Reverse complement: each base is replaced by its partner (A↔T, G↔C, N stays N) and the order is reversed. The output is grouped in blocks of 10 for easier reading.
• Translation (frame 1): starting at the first base, every three bases form a codon, translated with the standard genetic code. A stop codon is shown as *, and a codon containing N becomes X. Leftover bases at the end are ignored.
• Length is the number of cleaned bases.

The principle

Base pairing is fixed (A with T, G with C), and the strands are antiparallel: one runs 5′→3′ left to right, its partner 5′→3′ right to left. Writing the partner strand in the conventional 5′→3′ direction therefore requires both complementing and reversing. Translation follows the standard code of 64 codons: 61 encode amino acids and three (TAA, TAG, TGA) are stops. The tool looks codons up in a table ordered T, C, A, G for each position, computing an index of 16 × first + 4 × second + third.

Worked example

1. Input: ATGGCCATTGTAATGGGCCGCTGA, length 24 bp.
2. Complement each base: TACCGGTAACATTACCCGGCGACT.
3. Reverse it: TCAGCGGCCCATTACAATGGCCAT, displayed as TCAGCGGCCC ATTACAATGG CCAT.
4. Codons in frame 1: ATG GCC ATT GTA ATG GGC CGC TGA.
5. Translation: Met Ala Ile Val Met Gly Arg Stop = MAIVMGR*.

How to read the result

A protein that starts with M and ends with a single * at the end of the sequence suggests a complete open reading frame. Stops scattered through the middle usually mean the wrong frame or the wrong strand; translate the reverse complement too, or shift the start by one or two bases. Many X characters indicate ambiguous bases in the input.

Common mistakes

• Using only the complement (not reversed) when ordering a reverse primer.
• Pasting RNA with U; U is removed, so convert U to T first.
• Expecting all six frames; this tool translates frame 1 of the given strand only.

Frequently asked questions

What is the difference between complement and reverse complement?

The complement swaps each base but keeps the order (3′→5′); the reverse complement also reverses it so the strand reads 5′→3′, the standard way to write DNA.

How do I find the right reading frame?

Translate all three frames on both strands and look for the longest stretch without stops, usually starting with ATG.

Are IUPAC ambiguity codes like R or Y supported?

No. Only A, C, G, T and N are kept; other letters are dropped, which can shift the frame, so replace them with N first.

Sources: NCBI, The Genetic Codes (translation table 1, standard code) · Alberts, B. et al., Molecular Biology of the Cell (Garland Science)